pMSCV-PIG-miR-29b-1/miR-29a
(Plasmid #64231)

• Purpose: Expresses miR-29b-1 and miR-29a in mammalian cells
• Depositing Lab: Joshua Mendell
• Publication: Chang et al Nat Genet. 2008 Jan;40(1):43-50. Epub 2007 Dec 9.

Backbone

• Vector backbone: MSCV PIG
• Backbone manufacturer: Scott Lowe
• Backbone size w/o insert (bp): 7658
• Total vector size (bp): 8801
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miR-29b-1 and miR-29a
• Species: H. sapiens (human)
• Insert Size (bp): 1138
• GenBank ID: NR_029517 NR_029503
• Entrez Gene: MIR29A (a.k.a. MIRN29, MIRN29A, hsa-mir-29, hsa-mir-29a, miRNA29A, mir-29a)
• Entrez Gene: MIR29B1 (a.k.a. MIRN29B1, miR-29b, miRNA29B1, mir-29b-1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GATGTGGAATGTGTGCGAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry