pBa-KIF5C 559-tdTomato-FKBP
(Plasmid #64211)

• Purpose: KIF5C motor protein aa1-559 with C-terminal tandem dimer Tomato and FKBP tags
• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Bentley et al J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26.

Backbone

• Vector backbone: pBa.KIF5C 1-559.eGFP
• Backbone manufacturer: Banker lab (Addgene plasmid #45059)
• Backbone size w/o insert (bp): 8410
• Total vector size (bp): 9444
• Modifications to backbone: GFP removed and tdTomato-FKBP added
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kif5c
• Alt name: Kif5c560
• Alt name: kinesin family member 5C
• Species: R. norvegicus (rat)
• Insert Size (bp): 1676
• Mutation: motor domain aa1-559
• GenBank ID: NM_001107730.1
• Entrez Gene: Kif5c
• Promoter: chicken Beta Actin
• Tags / Fusion Proteins:
  • tdTomato (C terminal on insert)
  • FKBP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Kif 5c received from Bruce Schnapp, Oregon Health & Science University
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.