pBa-FRB-3myc-Rab5a
(Plasmid #64209)

• Purpose: Rab5a with N-terminal FRB and triple myc tags
• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Bentley et al J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26.

Backbone

• Vector backbone: pBa-FRB-3myc
• Backbone size w/o insert (bp): 6280
• Total vector size (bp): 7062
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab5a
• Alt name: Rab5
• Species: M. musculus (mouse)
• Insert Size (bp): 782
• GenBank ID: NM_025887
• Entrez Gene: Rab5a (a.k.a. 2410015H04Rik, nnyRab5a)
• Promoter: chicken Beta Actin
• Tags / Fusion Proteins:
  • FRB (N terminal on backbone)
  • 3myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: RsrII (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Rab5a received from Paul Barnes, Oregon Health & Science University

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.