sgRNA1_Tet-inducible Luciferase reporter
(Plasmid
#64161)
-
PurposePhotoactivatable transcription system. Mammalian expression of sgRNA1 to target Tet-inducible-luciferase reporter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSPgRNA
-
Backbone manufacturerCharles Gersbach, Addgene plasmid 47108
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA1 for Tet-inducible Luciferase reporter
-
gRNA/shRNA sequenceGTCTCTATCACTGATAGGGA
-
SpeciesSynthetic
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer TACGATACAAGGCTGTTA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA1_Tet-inducible Luciferase reporter was a gift from Moritoshi Sato (Addgene plasmid # 64161 ; http://n2t.net/addgene:64161 ; RRID:Addgene_64161) -
For your References section:
CRISPR-Cas9-based Photoactivatable Transcription System. Nihongaki Y, Yamamoto S, Kawano F, Suzuki H, Sato M. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. 10.1016/j.chembiol.2014.12.011 PubMed 25619936