Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sgRNA1_Tet-inducible Luciferase reporter
(Plasmid #64161)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64161 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSPgRNA
  • Backbone manufacturer
    Charles Gersbach, Addgene plasmid 47108
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA1 for Tet-inducible Luciferase reporter
  • gRNA/shRNA sequence
    GTCTCTATCACTGATAGGGA
  • Species
    Synthetic
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer TACGATACAAGGCTGTTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA1_Tet-inducible Luciferase reporter was a gift from Moritoshi Sato (Addgene plasmid # 64161 ; http://n2t.net/addgene:64161 ; RRID:Addgene_64161)
  • For your References section:

    CRISPR-Cas9-based Photoactivatable Transcription System. Nihongaki Y, Yamamoto S, Kawano F, Suzuki H, Sato M. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. 10.1016/j.chembiol.2014.12.011 PubMed 25619936