pBAD_His B_QuasAr1
(Plasmid #64135)

• Purpose: Fluorescent reporter for membrane voltage with improved brightness
• Depositing Lab: Adam Cohen
• Publication: Hochbaum et al Nat Methods. 2014 Aug;11(8):825-33. doi: 10.1038/nmeth.3000. Epub 2014 Jun 22.

Backbone

• Vector backbone: pBAD
• Backbone size w/o insert (bp): 3974
• Total vector size (bp): 4754
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: QuasAr1
• Alt name: Arch3.77H
• Species: Synthetic
• Insert Size (bp): 780

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XBAI (not destroyed)
• 3′ cloning site: HINDIII (not destroyed)
• 5′ sequencing primer: TGGGCTAACAGGAGGAATTAAC
• 3′ sequencing primer: TGGTGAGCAAGGGCTAGAAG

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
• A portion of this plasmid was derived from a plasmid made by: Dr. Yongxin Zhao, Univ. of Alberta
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The N and C termini differ slightly from the mammalian versions of QuasAr1 (Addgene 51629) and QuasAr2 (Addgene 51692), but these differences are not believed to be functionally significant.