pHAGE-TO-nmdCas9-3XmCherry
(Plasmid #64110)

• Purpose: Expression of Nm dCas9-3XmCherry in mammalian cells
• Depositing Lab: Thoru Pederson
• Publication: Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

Backbone

• Vector backbone: pHAGE-DEST
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 12104
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nm dCas9
• Species: Synthetic
• Insert Size (bp): 3243
• Promoter: CMV-TO
• Tag / Fusion Protein:
  • 3XmCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgaaggaatagaagaagaaggtgga
• 3′ sequencing primer: CCAAAGGGAGATCCGACTCG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry