pGATOR-DTA
(Plasmid #64103)

• Purpose: Tet inducible, Gateway adapted ROSA26 targeting Vector with DTA
• Depositing Lab: Bill Skarnes
• Publication: Melidoni et al Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7. doi: 10.1073/pnas.1312062110. Epub 2013 Sep 30.

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 23453
• Vector type: Mammalian Expression, Mouse Targeting ; Tet Inducible
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: rTTA
• Species: Synthetic
• Insert Size (bp): 1026
• Entrez Gene: Gt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
• Promoter: ROSA26 endogenous

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TCCAGGGTTTCCTTGATGAT
• 3′ sequencing primer: GTGAAAGTGGGTCCGCGTAC

Resource Information

• Supplemental Documents:
  • pGATOR-DTA Genbank
• A portion of this plasmid was derived from a plasmid made by: The pGATOR_DTA plasmid was generated John McCafferty’s lab at the University of Cambridge in collaboration with by Bill Skarnes’ lab (Sanger). Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. (https://www.ncbi.nlm.nih.gov/pubmed/24082130) Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry