pGATOR
(Plasmid #64102)

• Purpose: Tet inducible, Gateway adapted ROSA26 targeting Vector
• Depositing Lab: Bill Skarnes
• Publication: Melidoni et al Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7. doi: 10.1073/pnas.1312062110. Epub 2013 Sep 30.

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 23453
• Vector type: Mammalian Expression, Mouse Targeting ; Tet Inducible
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: rTTA
• Species: Synthetic
• Insert Size (bp): 1026
• Entrez Gene: Gt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
• Promoter: ROSA26 endogenous

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGATCTGTAGGGCGCAGTAG
• 3′ sequencing primer: AGACGATTTCGATCTGGACA

Resource Information

• Supplemental Documents:
  • pGator Genbank
• A portion of this plasmid was derived from a plasmid made by: The pGATOR vector was at Bill Skarnes’ lab (Sanger) and is a modification of a Rosa26 targeting vector obtained from Anton Berns’ lab (a scientist at Netherland Cancer Institute - NKI), described in this paper: A highly efficient ligand-regulated Cre recombinase mouse line shows that LoxP recombination is position dependent. (https://www.ncbi.nlm.nih.gov/pubmed/11306549) Vooijs M, Jonkers J, Berns A. EMBO Rep. 2001 Apr;2(4):292-7.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry