Addgene: MLS-mir-17-92-Mut92 Skip to main content
Addgene

MLS-mir-17-92-Mut92
(Plasmid #64094)

Full plasmid sequence is not available for this item.

Created with RaphaëlMLS-mir-17-92-Mut92EcoR1miR-17-92Xho1

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64094 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMSCV-SV40-GFP
  • Backbone size w/o insert (bp) 6216
  • Total vector size (bp) 7166
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-17-92
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    950
  • Mutation
    mutation of miR-92 seed sequence
  • Entrez Gene
    MIR17HG (a.k.a. C13orf25, FGLDS2, LINC00048, MIHG1, MIRH1, MIRHG1, NCRNA00048, miR-17-92)
  • Promoter MSCV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GCCCTCACTCCTTCTCTAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MLS-mir-17-92-Mut92 was a gift from Lin He (Addgene plasmid # 64094 ; http://n2t.net/addgene:64094 ; RRID:Addgene_64094)
  • For your References section:

    A component of the mir-17-92 polycistronic oncomir promotes oncogene-dependent apoptosis. Olive V, Sabio E, Bennett MJ, De Jong CS, Biton A, McGann JC, Greaney SK, Sodir NM, Zhou AY, Balakrishnan A, Foth M, Luftig MA, Goga A, Speed TP, Xuan Z, Evan GI, Wan Y, Minella AC, He L. Elife. 2013 Oct 15;2:e00822. doi: 10.7554/eLife.00822. 10.7554/eLife.00822 PubMed 24137534