Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

L309-myc-seipin-WT
(Plasmid #64061)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64061 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    L309
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bscl2
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Bscl2 (a.k.a. 2900097C17Rik, Gng3lg)
  • Tag / Fusion Protein
    • myc epitope (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    L309-myc-seipin-WT was a gift from Weiping Han (Addgene plasmid # 64061 ; http://n2t.net/addgene:64061 ; RRID:Addgene_64061)
  • For your References section:

    Seipin differentially regulates lipogenesis and adipogenesis through a conserved core sequence and an evolutionarily acquired C-terminus. Yang W, Thein S, Guo X, Xu F, Venkatesh B, Sugii S, Radda GK, Han W. Biochem J. 2013 May 15;452(1):37-44. doi: 10.1042/BJ20121870. 10.1042/BJ20121870 PubMed 23458123