L304-EGFP-Tubulin-K40R
(Plasmid
#64059)
-
PurposeEGFP fused at the N-terminus of tubulin with a mutation K40R; lentiviral construct
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneL304
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametubulin
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L304-EGFP-Tubulin-K40R was a gift from Weiping Han (Addgene plasmid # 64059 ; http://n2t.net/addgene:64059 ; RRID:Addgene_64059) -
For your References section:
Regulation of adipogenesis by cytoskeleton remodelling is facilitated by acetyltransferase MEC-17-dependent acetylation of alpha-tubulin. Yang W, Guo X, Thein S, Xu F, Sugii S, Baas PW, Radda GK, Han W. Biochem J. 2013 Feb 1;449(3):605-12. doi: 10.1042/BJ20121121. 10.1042/BJ20121121 PubMed 23126280