pFETCh_RAD21
(Plasmid #64056)

• Purpose: Homology Arms and 3X Flag with P2A Neo for 3' tagging of human RAD21
• Depositing Labs: Eric Mendenhall, Richard M. Myers
• Publication: Savic et al Genome Res. 2015 Sep 9.

Backbone

• Vector backbone: pFETCH_Donor
• Backbone size w/o insert (bp): 5771
• Total vector size (bp): 7200
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RAD21 Homology Arms
• Alt name: RAD21
• Alt name: SCC1
• Species: H. sapiens (human)
• Insert Size (bp): 1600
• Entrez Gene: RAD21 (a.k.a. CDLS4, HR21, HRAD21, MCD1, MGS, NXP1, SCC1, hHR21)
• Tag / Fusion Protein:
  • 3X Flag P2A Neo (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acgcctgtgaaaccgtacta
• 3′ sequencing primer: aactgttgggaagggcgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has been used along with PX548_RAD21_1 to add a FLAG tag to human RAD21 in HepG2 and MCF7 cells by the Mendenhall and Myers labs at HudsonAlpha Institute for Biotechnology/UAH. Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.