Skip to main content
Addgene

pFETCh_CEBPB
(Plasmid #64055)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64055 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFETCH_Donor
  • Backbone size w/o insert (bp) 5771
  • Total vector size (bp) 7252
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CEBPB Homology Arms
  • Alt name
    C/EBPB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1600
  • Entrez Gene
    CEBPB (a.k.a. C/EBP-beta, IL6DBP, NF-IL6, TCF5)
  • Tag / Fusion Protein
    • 3X Flag P2A Neo (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgcctgtgaaaccgtacta
  • 3′ sequencing primer aactgttgggaagggcgatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid has been used along with PX548_CEBPB_1 and PX548_CEBPB_2 to add a FLAG tag to human CEBPB in HepG2 and MCF7 cells by the Mendenhall and Myers labs at HudsonAlpha Institute for Biotechnology/UAH Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFETCh_CEBPB was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 64055 ; http://n2t.net/addgene:64055 ; RRID:Addgene_64055)
  • For your References section:

    CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Savic D, Partridge EC, Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. Genome Res. 2015 Sep 9. 10.1101/gr.193540.115 PubMed 26355004