pDestTol2pACryGFP
(Plasmid #64022)

• Purpose: Gateway destination vector with zebrafish aA-crystallin promoter driving GFP in lens
• Depositing Labs: Joachim Berger, Peter Currie
• Publication: Berger et al Genesis. 2013 Jun;51(6):443-7. doi: 10.1002/dvg.22385. Epub 2013 Mar 26.

Backbone

• Vector backbone: pDestTol2pA2
• Backbone manufacturer: Kwan et al., 2007
• Vector type: Gateway
• Selectable markers: ccdB gene

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: to be propagated like other Gateway destination vectors (such as pDESTR4-R3) with Chloramphenicol resistance. Invitrogen recommend their "ccdB Survival 2 T1R E. coli strain" plus 100 μg/ml ampicillin and 15–30 μg/ml chloramphenicol.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP
• Species: D. rerio (zebrafish)
• Promoter: alpha-Acrystallin promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SfiI (unknown if destroyed)
• 5′ sequencing primer: M13Forward
• 3′ sequencing primer: AGAGAGCATTATTGTAGGAAATG

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry