pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
(Plasmid
#63887)
-
PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene Plasmid #50465
-
Backbone manufacturerBryan Roth
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameER-localized low-affinity GCaMP3(10.19)
-
SpeciesSynthetic
- Promoter human SYN1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site bamhi (unknown if destroyed)
- 3′ cloning site ecori (unknown if destroyed)
- 5′ sequencing primer hSYN1 F417 actcagcgctgcctcagtct
- 3′ sequencing primer WPRE_R1 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL was a gift from Brandon Harvey (Addgene plasmid # 63887 ; http://n2t.net/addgene:63887 ; RRID:Addgene_63887) -
For your References section:
A Low Affinity GCaMP3 Variant (GCaMPer) for Imaging the Endoplasmic Reticulum Calcium Store. Henderson MJ, Baldwin HA, Werley CA, Boccardo S, Whitaker LR, Yan X, Holt GT, Schreiter ER, Looger LL, Cohen AE, Kim DS, Harvey BK. PLoS One. 2015 Oct 9;10(10):e0139273. doi: 10.1371/journal.pone.0139273. eCollection 2015. PONE-D-15-20579 [pii] PubMed 26451944