pOTTC813 - pAAV-SYN1-CRTsigpep-GCaMP3-KDEL
(Plasmid #63886)

• Purpose: An AAV packaging vector that expresses ER-retained GCaMP3 under control of the SYN1 promoter.
• Depositing Lab: Brandon Harvey
• Publication: Henderson et al PLoS One. 2015 Oct 9;10(10):e0139273. doi: 10.1371/journal.pone.0139273. eCollection 2015.

Backbone

• Vector backbone: Addgene Plasmid #50465
• Backbone manufacturer: Bryan Roth
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ER-localized GCaMP3(wt)
• Species: Synthetic
• Promoter: human SYN1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: bamhi (unknown if destroyed)
• 3′ cloning site: ecori (unknown if destroyed)
• 5′ sequencing primer: hSYN1 F417 actcagcgctgcctcagtct
• 3′ sequencing primer: WPRE_R1

Resource Information

• Supplemental Documents:
  • pOTTC813 - annotated GENBANK file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry