Skip to main content
Addgene

pGL3-SV40P-Tet1 enhancer E
(Plasmid #63880)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63880 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL3-Promoter
  • Backbone size w/o insert (bp) 5005
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tet1 enhancer fragment E
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1383
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer SV40pA-R
  • 3′ sequencing primer RVprimer4 (GACGATAGTCATGCCCCGCG)
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-SV40P-Tet1 enhancer E was a gift from Kian Peng Koh (Addgene plasmid # 63880 ; http://n2t.net/addgene:63880 ; RRID:Addgene_63880)

  • For your References section:

    Dynamic switching of active promoter and enhancer domains regulates Tet1 and Tet2 expression during cell state transitions between pluripotency and differentiation. Sohni A, Bartoccetti M, Khoueiry R, Spans L, Vande Velde J, De Troyer L, Pulakanti K, Claessens F, Rao S, Koh KP. Mol Cell Biol. 2015 Mar 15;35(6):1026-42. doi: 10.1128/MCB.01172-14. Epub 2015 Jan 12. 10.1128/MCB.01172-14 PubMed 25582196
Related items:
Commonly requested with: