AEB-F12
(Plasmid
#63849)
-
PurposeThis pFTV1 vector contains a fluoride binding riboswitch, controlling the translation initaition rate of mRFP1 gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFTV1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameF12 fluoride riboswitch
-
SpeciesSynthetic
- Promoter J23100
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer RNAde-BB-3 (tacggacgaccttcaccttc) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AEB-F12 was a gift from Howard Salis (Addgene plasmid # 63849 ; http://n2t.net/addgene:63849 ; RRID:Addgene_63849) -
For your References section:
Automated physics-based design of synthetic riboswitches from diverse RNA aptamers. Espah Borujeni A, Mishler DM, Wang J, Huso W, Salis HM. Nucleic Acids Res. 2015 Nov 30. pii: gkv1289. 10.1093/nar/gkv1289 PubMed 26621913