rpoS200-RFP
(Plasmid #63840)

• Purpose: This plasmid is designed as a bacterial stationary phase sensor
• Depositing Lab: Howard Salis
• Publication: Salis Lab Plasmids (unpublished)

Backbone

• Vector backbone: P15A
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: rpoS, mRFP1 and GFPmut3b
• Mutation: Gene is translationally fused to RFP
• Tag / Fusion Protein:
  • mRFP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: RNAde-BB-3 (tacggacgaccttcaccttc)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry