mRFP1-29
(Plasmid
#63822)
-
PurposeA member of an RBS library for mRFP1 with different translation rates
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63822 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFTV
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRFP1
-
SpeciesSynthetic
-
MutationCodon optimized for E.coli
- Promoter J23100
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer RNAde-BB-3 (tacggacgaccttcaccttc) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mRFP1-29 was a gift from Howard Salis (Addgene plasmid # 63822 ; http://n2t.net/addgene:63822 ; RRID:Addgene_63822) -
For your References section:
Efficient search, mapping, and optimization of multi-protein genetic systems in diverse bacteria. Farasat I, Kushwaha M, Collens J, Easterbrook M, Guido M, Salis HM. Mol Syst Biol. 2014 Jun 21;10:731. doi: 10.15252/msb.20134955. PubMed 24952589