pAWG-dCas9-VPR
(Plasmid #63802)

• Purpose: SP-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; drosophila vector
• Depositing Lab: George Church
• Publication: Chavez et al Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312.

Backbone

• Vector backbone: pAWG
• Vector type: Insect Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SP-dCas9-VPR
• Alt name: VP64-p65-Rta
• Species: D. melanogaster (fly)
• Insert Size (bp): 5733
• Promoter: act5c
• Tag / Fusion Protein:
  • VPR (VP64-p65-Rta) (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ATCGGCGAACAATTCATACC

Resource Information

• Supplemental Documents:
  • pAWG-SP-dCas9-VPR
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid contains a stop codon between dCas9-VPR and eGFP and does NOT produce a GFP fusion protein.

Cas9 contains D839A and N863A mutations. Depositor states that these mutations should not affect function.