-
PurposeSP-dCas9-VPR with doxycycline-inducible expression
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonePB-TRE
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology ; Piggybac
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VPR
-
Alt nameVP64-p65-Rta
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)5733
- Promoter TRE
-
Tag
/ Fusion Protein
- VPR (VP64-p65-Rta) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTCCCCAGAAGGAAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TRE-dCas9-VPR was a gift from George Church (Addgene plasmid # 63800 ; http://n2t.net/addgene:63800 ; RRID:Addgene_63800) -
For your References section:
Highly efficient Cas9-mediated transcriptional programming. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan D, Braff JL, Davidsohn N, Housden BE, Perrimon N, Weiss R, Aach J, Collins JJ, Church GM. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. 10.1038/nmeth.3312 PubMed 25730490
