pGS1112
(Plasmid #63784)

• Purpose: Vector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal eSapphire Strep-tag II followed by URA3 selection marker
• Depositing Labs: Monika Golas, Bjoern Sander
• Publication: Rai et al Mol Biotechnol. 2014 Jun 27.

Backbone

• Vector backbone: pGS1212
• Backbone size w/o insert (bp): 4940
• Total vector size (bp): 4940
• Vector type: E. coli cloning vector
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eSapphire-Strep-tag II followed by URA3
• Species: Synthetic
• Promoter: none
• Tag / Fusion Protein:
  • Sapphire-Strep-tag II (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: BsrGI/Bsp1407I (not destroyed)
• 5′ sequencing primer: CTGGCTTAACTATGCGGCATCAG
• 3′ sequencing primer: gcaacctgacctacaggaaagag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Mark A. Sheff and Kurt S. Thorn

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The sequence of the eSapphire gene has been optimized for S. cerevisiae and generated by gene synthesis. The Strep-tag II sequence is adapted from the sequence of commercial Strep-tag II plasmids offered by IBA, Goettingen, Germany.