-
PurposeExpressing mCherry from BLBP promoter which is a neural stem cell (radial glial cells) specific promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG-mCherry
- Backbone size w/o insert (bp) 1700
- Total vector size (bp) 5572
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBLBP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1700
-
Mutation1700 bp upstream of BLBP gene cloned in CAG-mCherry
-
Entrez GeneFabp7 (a.k.a. B-FABP, BFABP, Blbp, MRG)
- Promoter 1700bp upstream of BLBP gene
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CAATGTCGACAGCACAGCAGAAAGGGAAAA
- 3′ sequencing primer GGTGGGCGCGCCAGGCAGGAACTGGAGGAACTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BLBP-mCherry was a gift from Bart De Strooper (Addgene plasmid # 63721 ; http://n2t.net/addgene:63721 ; RRID:Addgene_63721) -
For your References section:
APLP2 regulates neuronal stem cell differentiation during cortical development. Shariati SA, Lau P, Hassan BA, Muller U, Dotti CG, De Strooper B, Gartner A. J Cell Sci. 2013 Mar 1;126(Pt 5):1268-77. doi: 10.1242/jcs.122440. Epub 2013 Jan 23. 10.1242/jcs.122440 PubMed 23345401