pX330_sgACTA2
(Plasmid
#63712)
-
PurposeExpress sgACTA2 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
- Total vector size (bp) 8518
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACTA2
-
gRNA/shRNA sequencegcggtggacaatggaaggcc
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Entrez GeneACTA2 (a.k.a. ACTSA)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_sgACTA2 was a gift from Stanley Qi (Addgene plasmid # 63712 ; http://n2t.net/addgene:63712 ; RRID:Addgene_63712) -
For your References section:
Small Molecules Enhance CRISPR Genome Editing in Pluripotent Stem Cells. Yu C, Liu Y, Ma T, Liu K, Xu S, Zhang Y, Liu H, La Russa M, Xie M, Ding S, Qi LS. Cell Stem Cell. 2015 Feb 5;16(2):142-7. doi: 10.1016/j.stem.2015.01.003. 10.1016/j.stem.2015.01.003 PubMed 25658371