Skip to main content
Addgene

pP2A_NLS_sfGFP
(Plasmid #63709)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63709 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2241
  • Total vector size (bp) 7295
  • Vector type
    Just a donor DNA with Nanog homologous arm for knock-in sfGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nanog homologous arm, p2A, NLS, sfGFP, Nanog homologous arm
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    5054
  • Tag / Fusion Protein
    • sfGFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgttcttcggggcgaaaactctc
  • 3′ sequencing primer cacttctgagttcggcatgggg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pP2A_NLS_sfGFP was a gift from Stanley Qi (Addgene plasmid # 63709 ; http://n2t.net/addgene:63709 ; RRID:Addgene_63709)

  • For your References section:

    Small Molecules Enhance CRISPR Genome Editing in Pluripotent Stem Cells. Yu C, Liu Y, Ma T, Liu K, Xu S, Zhang Y, Liu H, La Russa M, Xie M, Ding S, Qi LS. Cell Stem Cell. 2015 Feb 5;16(2):142-7. doi: 10.1016/j.stem.2015.01.003. 10.1016/j.stem.2015.01.003 PubMed 25658371
Related items:
Commonly requested with: