Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p3.2mar-Luc
(Plasmid #63696)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63696 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTA-Luc
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4890
  • Total vector size (bp) 8064
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3.2 kb marine stickleback armor plate enhancer
  • Species
    Stickleback (G. aculeatus)
  • Insert Size (bp)
    3187
  • Promoter TATA box
  • Tag / Fusion Protein
    • Luciferase

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (unknown if destroyed)
  • 3′ cloning site Xho1 (unknown if destroyed)
  • 5′ sequencing primer AGGTGCCAGAACATTTCTCTATCGA
  • 3′ sequencing primer AACAGTACCGGAATGCCAAGCTGGA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3.2mar-Luc was a gift from David Kingsley (Addgene plasmid # 63696 ; http://n2t.net/addgene:63696 ; RRID:Addgene_63696)
  • For your References section:

    A recurrent regulatory change underlying altered expression and Wnt response of the stickleback armor plates gene EDA. O'Brown NM, Summers BR, Jones FC, Brady SD, Kingsley DM. Elife. 2015 Jan 28;4:e05290. doi: 10.7554/eLife.05290. 10.7554/eLife.05290 PubMed 25629660