p3.2mar(T->G)-GFP
(Plasmid
#63695)
-
Purpose3.2 kb marine armor plate enhancer with a single T->G bp change driving GFP reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepT2HE
-
Backbone manufacturerTim Howes
- Backbone size w/o insert (bp) 6440
- Total vector size (bp) 9627
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3.2 kb marine stickleback armor plate enhancer with a single T->G base pair change
-
SpeciesStickleback (G. aculeatus)
-
Insert Size (bp)3187
-
MutationT->G bp change
- Promoter hsp70
-
Tag
/ Fusion Protein
- EGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sfi1 (unknown if destroyed)
- 3′ cloning site Sfi1 (unknown if destroyed)
- 5′ sequencing primer TAGCAGGAAACGTGAGCAGAGAC
- 3′ sequencing primer GGAAATAACCAAGCGACACCCCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3.2mar(T->G)-GFP was a gift from David Kingsley (Addgene plasmid # 63695 ; http://n2t.net/addgene:63695 ; RRID:Addgene_63695) -
For your References section:
A recurrent regulatory change underlying altered expression and Wnt response of the stickleback armor plates gene EDA. O'Brown NM, Summers BR, Jones FC, Brady SD, Kingsley DM. Elife. 2015 Jan 28;4:e05290. doi: 10.7554/eLife.05290. 10.7554/eLife.05290 PubMed 25629660