Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pVTU_260_BirA
(Plasmid #63682)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63682 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pVTU-260
  • Backbone manufacturer
    Euroscarf
  • Backbone size w/o insert (bp) 6929
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BirA
  • Alt name
    E coli biotin ligase
  • Species
    E. coli
  • Insert Size (bp)
    966
  • Promoter ADH1/yeast
  • Tags / Fusion Proteins
    • 6X Histidine (N terminal on backbone)
    • TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5' TTTTCTGCACAATATTTCAAGC� 3'
  • 3′ sequencing primer 5' AGTCCAAAGCTGGATCCTTATTT� 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVTU_260_BirA was a gift from Aaron Hoskins (Addgene plasmid # 63682 ; http://n2t.net/addgene:63682 ; RRID:Addgene_63682)
  • For your References section:

    Rapid isolation and single-molecule analysis of ribonucleoproteins from cell lysate by SNAP-SiMPull. Rodgers ML, Paulson J, Hoskins AA. RNA. 2015 May;21(5):1031-41. doi: 10.1261/rna.047845.114. Epub 2015 Mar 24. 10.1261/rna.047845.114 PubMed 25805862