pVTU_260_BirA
(Plasmid #63682)

• Purpose: Encodes E. coli biotin ligase gene (BirA) for expression in yeast cells
• Depositing Lab: Aaron Hoskins
• Publication: Rodgers et al RNA. 2015 May;21(5):1031-41. doi: 10.1261/rna.047845.114. Epub 2015 Mar 24.

Backbone

• Vector backbone: pVTU-260
• Backbone manufacturer: Euroscarf
• Backbone size w/o insert (bp): 6929
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BirA
• Alt name: E coli biotin ligase
• Species: E. coli
• Insert Size (bp): 966
• Promoter: ADH1/yeast
• Tags / Fusion Proteins:
  • 6X Histidine (N terminal on backbone)
  • TEV cleavage site (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5' TTTTCTGCACAATATTTCAAGC� 3'
• 3′ sequencing primer: 5' AGTCCAAAGCTGGATCCTTATTT� 3'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry