-
PurposePITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC ori vector
-
Vector typeCRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-2A-PuroR
-
SpeciesSynthetic
- Promoter Promoterless
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAGGTCAGGGTGGTCACGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRIS-PITChv2-FBL was a gift from Takashi Yamamoto (Addgene plasmid # 63672 ; http://n2t.net/addgene:63672 ; RRID:Addgene_63672) -
For your References section:
MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Sakuma T, Nakade S, Sakane Y, Suzuki KT, Yamamoto T. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17. 10.1038/nprot.2015.140 PubMed 26678082