-
PurposeExpresses Cas9 nuclease, FBL-specific gRNA, and the PITCh-gRNA
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC ori vector
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes Cas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4272
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330A-FBL/PITCh was a gift from Takashi Yamamoto (Addgene plasmid # 63671 ; http://n2t.net/addgene:63671 ; RRID:Addgene_63671) -
For your References section:
MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Sakuma T, Nakade S, Sakane Y, Suzuki KT, Yamamoto T. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17. 10.1038/nprot.2015.140 PubMed 26678082