pX330S-2-PITCh
(Plasmid #63670)

• Purpose: Expresses Cas9 nuclease and the PITCh-gRNA
• Depositing Lab: Takashi Yamamoto
• Publication: Sakuma et al Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17.

Backbone

• Vector backbone: pUC ori vector
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized S. pyogenes Cas9
• Species: S. pyogenes
• Insert Size (bp): 4272
• Promoter: CBh
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7 (TAATACGACTCACTATAGGG)

Resource Information

• Supplemental Documents:
  • GenBank file
• A portion of this plasmid was derived from a plasmid made by: Feng Zhang
• Articles Citing this Plasmid:
  • 12 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry