pX330A_dCas9-1x6
(Plasmid
#63600)
-
PurposeExpresses dCas9 and gRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63600 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC ori vector
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes dCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4272
-
MutationD1361Y
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330A_dCas9-1x6 was a gift from Takashi Yamamoto (Addgene plasmid # 63600 ; http://n2t.net/addgene:63600 ; RRID:Addgene_63600) -
For your References section:
Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. Nakagawa Y, Sakuma T, Sakamoto T, Ohmuraya M, Nakagata N, Yamamoto T. BMC Biotechnol. 2015 May 22;15(1):33. 10.1186/s12896-015-0144-x [pii] PubMed 25997509