pBa-eGFP-flag-BicD2 594-FKBP
(Plasmid #63569)

• Purpose: Bicaudal D protein aa1-594 (excluding start Met) tagged with N-terminal eGFP and flag and a C-terminal FKBP
• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Bentley et al J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26.

Backbone

• Vector backbone: pBa-eGFP-FKBP
• Backbone size w/o insert (bp): 7041
• Total vector size (bp): 8871
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bicaudal D protein
• Alt name: BicD2
• Species: M. musculus (mouse)
• Insert Size (bp): 1830
• Mutation: no start methionine, aa1-594
• GenBank ID: AJ250106
• Entrez Gene: Bicd2
• Promoter: chicken Beta Actin
• Tags / Fusion Proteins:
  • eGFP (N terminal on backbone)
  • flag (N terminal on insert)
  • FKBP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: RsrII (not destroyed)
• 5′ sequencing primer: CCAACGAGAAGCGCGATCACAT
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: bicaudal D2 mouse from ATCC
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.