Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDual-eGFP(H66)
(Plasmid #63558)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63558 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDual-eGFP
  • Backbone size w/o insert (bp) 10680
  • Total vector size (bp) 10947
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    eGFP is strongly expressed in the Rosetta-gami™2(DE3) strain (EMD Millipore) following IPTG induction of the T7 RNA polymerase gene.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    His-T7-eGFP(H66)
  • Alt name
    His-tagged, T7-tagged Azure (blue) variant of enhanced green fluorescent protein
  • Species
    Synthetic
  • Insert Size (bp)
    864
  • Mutation
    Changed tyrosine at position 66 with respect to the original eGFP sequence to a histidina codon. The DNA sequence change corresponds to T at nucleotide 316 to C.
  • GenBank ID
    KM019174
  • Promoter CMV-EF1α hybrid (CEF)
  • Tags / Fusion Proteins
    • His6 (N terminal on insert)
    • T7 (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgtcgccgtccagctcgaccag
  • 3′ sequencing primer gagcaagggcgaggagctgttc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lentiviral vector with high transduction efficiency. Expression from the CMV-EF1α hybrid (CEF) promoter is very stable in mammalian cells. The lentivirus contains an SV40 origin 5’ to the eGFP gene. This influences gene targeting rates and the preferred strand for gene targeting and recombineering in cells expressing the SV40 T-antigen.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDual-eGFP(H66) was a gift from Richard S Myers (Addgene plasmid # 63558 ; http://n2t.net/addgene:63558 ; RRID:Addgene_63558)
  • For your References section:

    Fluorescent protein engineering by in vivo site-directed mutagenesis. Valledor M, Hu Q, Schiller P, Myers RS. IUBMB Life. 2012 Aug;64(8):684-9. doi: 10.1002/iub.1041. Epub 2012 May 28. 10.1002/iub.1041 PubMed 22639380