pDual-eGFP(Stop66)
(Plasmid #63218)

• Purpose: Expression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.
• Depositing Lab: Richard S Myers
• Publication: Valledor et al IUBMB Life. 2012 Aug;64(8):684-9. doi: 10.1002/iub.1041. Epub 2012 May 28.

Backbone

• Vector backbone: pDual-eGFP
• Backbone size w/o insert (bp): 10947
• Total vector size (bp): 10947
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: eGFP is strongly expressed in the Rosetta-gami™2(DE3) strain (EMD Millipore) following IPTG induction of the T7 RNA polymerase gene.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: His-T7-eGFP(Stop66)
• Alt name: His-tagged, T7-tagged dark variant of enhanced green fluorescent protein
• Species: Synthetic
• Insert Size (bp): 864
• Mutation: Changed tyrosine at position 66 with respect to the original eGFP sequence to a stop codon. The DNA sequence change corresponds to C at nucleotide 318 to G.
• GenBank ID: KM019173
• Promoter: CMV-EF1α hybrid (CEF)
• Tags / Fusion Proteins:
  • his6 (N terminal on insert)
  • T7 (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cgtcgccgtccagctcgaccag
• 3′ sequencing primer: gagcaagggcgaggagctgttc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Lentiviral vector with high transduction efficiency. Expression from the CMV-EF1α hybrid (CEF) promoter is very stable in mammalian cells. The lentivirus contains an SV40 origin 5’ to the eGFP gene. This influences gene targeting rates and the preferred strand for gene targeting and recombineering in cells expressing the SV40 T-antigen.