pDual-eGFP
(Plasmid #63215)

• Purpose: Expression of eGFP in bacteria and in mammalian cells. Used as a reporter for quantifying gene targeting and recombineering in mammalian cells.
• Depositing Lab: Richard S Myers
• Publication: Valledor et al IUBMB Life. 2012 Aug;64(8):684-9. doi: 10.1002/iub.1041. Epub 2012 May 28.

Backbone

• Vector backbone: pNL-eGFP/CEF
• Backbone manufacturer: Jakob Reiser
• Backbone size w/o insert (bp): 10680
• Total vector size (bp): 10947
• Modifications to backbone: A PCR product amplified from pET28a was ligated to the SmaI digested pNL-eGFP/CEF (Zhang et al. 2002; Zhang et al. 2004; Reiser et al. 2000) and screened for gain of green fluorescence using a Dark Reader light box. The PCR product starts with a BglII sequence and then amplifies the T7 promoter, the LacI binding site (Lac operator), a Shine-Dalgarno sequence, His6, T7 tag, and ends at the beginning of the pET28a MCS. eGFP was strongly expressed from the Rosetta-gami™2(DE3) strain, which bears the T7 RNA polymerase gene. If desired, the insert may be excised again by cleavage with BglII and BamHI and religating. NcoI/XhoI excises eGFP and produces a product that can by ligated to pET28a (NcoI/XhoI) to create a T7 expressed eGFP with a C-terminal His tag for purification.
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: eGFP is strongly expressed in the Rosetta-gami™2(DE3) strain (EMD Millipore) following IPTG induction of the T7 RNA polymerase gene.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: His-T7-eGFP
• Alt name: His-tagged, T7-tagged enhanced green fluorescent protein
• Species: Synthetic
• Insert Size (bp): 864
• GenBank ID: KM019171
• Promoter: CMV-EF1α hybrid (CEF)
• Tags / Fusion Proteins:
  • His6 (N terminal on insert)
  • T7 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: cgtcgccgtccagctcgaccag
• 3′ sequencing primer: gagcaagggcgaggagctgttc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Lentiviral vector with high transduction efficiency. Expression from the CMV-EF1α hybrid (CEF) promoter is very stable in mammalian cells. The lentivirus contains an SV40 origin 5’ to the eGFP gene. This influences gene targeting rates and the preferred strand for gene targeting and recombineering in cells expressing the SV40 T-antigen.