tubP-FRT>GAL80-6-FRT>
(Plasmid #63173)

• Purpose: ubiquitous expression of a "flp-Out" Drosophila codon-optimized GAL80 gene cassette
• Depositing Lab: Gerald Rubin
• Publication: Nern et al Proc Natl Acad Sci U S A. 2015 May 11. pii: 201506763.

Backbone

• Vector backbone: pBDP
• Total vector size (bp): 12321
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: "Flp-Out" GAL80
• Species: M. musculus (mouse), D. melanogaster (fly), S. cerevisiae (budding yeast)
• Insert Size (bp): 3128

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGAATGGCTCTTAAAATCTAC
• 3′ sequencing primer: GTAGTGGGAAGCCACCTGGATTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry