pJFRC210-10XUAS-FRT>STOP>FRT-myr::smGFP-OLLAS
(Plasmid #63170)

• Purpose: GAL4-responsive UAS “flp-On” spaghetti monster GFP-OLLAS reporter
• Depositing Lab: Gerald Rubin
• Publication: Nern et al Proc Natl Acad Sci U S A. 2015 May 11. pii: 201506763.

Backbone

• Vector backbone: pJFRC12-10XUAS-IVS-myr::GFP
• Total vector size (bp): 10121
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: "spaghetti monster GFP-OLLAS"
• Alt name: smGFP-OLLAS
• Species: D. melanogaster (fly)
• Insert Size (bp): 1522
• Tag / Fusion Protein:
  • N-myristoylation (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GACTACACCTTTGGCCAGACG
• 3′ sequencing primer: CATCAGTCGCGGTCCCAGCTCG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry