-
PurposeSuicide plasmid for efficient gene mutation in Gram-positive bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMAD
-
Backbone manufacturerArnaud et al. 2004. Applied and Environmental Microbiology, 70:6887-6891
- Backbone size w/o insert (bp) 9666
- Total vector size (bp) 8995
-
Modifications to backboneThermostable -galactosidase (bgaB) was removed from pMAD using BglII and BseRI restriction enzymes.
-
Vector typeSuicide plasmid for Gram-positive bacteria
-
Selectable markersErythromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameanti-secY-Pxyl/tetO-tetR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BglII (destroyed during cloning)
- 5′ sequencing primer GATCTAATGATTCAAACCCTTGTG
- 3′ sequencing primer TGAAGTTACCATCACGGAAAAAGG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byGene origin is described in our publication describing pHoss1 (gene was PCR amplified from pIMAY vector) https://www.ncbi.nlm.nih.gov/pubmed/26038185
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Addgene's quality control sequencing finds an H63R amino acid residue substitution in the TetR ORF. This residue change does not affect TetR activity, and the plasmid functions as described.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHoss1 was a gift from Attila Karsi (Addgene plasmid # 63158 ; http://n2t.net/addgene:63158 ; RRID:Addgene_63158) -
For your References section:
A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes. Abdelhamed H, Lawrence ML, Karsi A. Plasmid. 2015 May 31;81:1-8. doi: 10.1016/j.plasmid.2015.05.003. 10.1016/j.plasmid.2015.05.003 PubMed 26038185