Skip to main content
Addgene

pHoss1
(Plasmid #63158)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63158 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMAD
  • Backbone manufacturer
    Arnaud et al. 2004. Applied and Environmental Microbiology, 70:6887-6891
  • Backbone size w/o insert (bp) 9666
  • Total vector size (bp) 8995
  • Modifications to backbone
    Thermostable -galactosidase (bgaB) was removed from pMAD using BglII and BseRI restriction enzymes.
  • Vector type
    Suicide plasmid for Gram-positive bacteria
  • Selectable markers
    Erythromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    anti-secY-Pxyl/tetO-tetR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer GATCTAATGATTCAAACCCTTGTG
  • 3′ sequencing primer TGAAGTTACCATCACGGAAAAAGG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Gene origin is described in our publication describing pHoss1 (gene was PCR amplified from pIMAY vector) https://www.ncbi.nlm.nih.gov/pubmed/26038185

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Addgene's quality control sequencing finds an H63R amino acid residue substitution in the TetR ORF. This residue change does not affect TetR activity, and the plasmid functions as described.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHoss1 was a gift from Attila Karsi (Addgene plasmid # 63158 ; http://n2t.net/addgene:63158 ; RRID:Addgene_63158)
  • For your References section:

    A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes. Abdelhamed H, Lawrence ML, Karsi A. Plasmid. 2015 May 31;81:1-8. doi: 10.1016/j.plasmid.2015.05.003. 10.1016/j.plasmid.2015.05.003 PubMed 26038185