Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MT79
(Plasmid #63112)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63112 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGreenIIS BAR
  • Backbone size w/o insert (bp) 6175
  • Total vector size (bp) 6580
  • Modifications to backbone
    35S CaMV promoter, 0cs 3' corrected terminator
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    amiR-ACD6
  • gRNA/shRNA sequence
    ACAGCCTTTAGTCTCCATTAT

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MT79 was a gift from Detlef Weigel (Addgene plasmid # 63112 ; http://n2t.net/addgene:63112 ; RRID:Addgene_63112)
  • For your References section:

    Natural allelic variation underlying a major fitness trade-off in Arabidopsis thaliana. Todesco M, Balasubramanian S, Hu TT, Traw MB, Horton M, Epple P, Kuhns C, Sureshkumar S, Schwartz C, Lanz C, Laitinen RA, Huang Y, Chory J, Lipka V, Borevitz JO, Dangl JL, Bergelson J, Nordborg M, Weigel D. Nature. 2010 Jun 3;465(7298):632-6. doi: 10.1038/nature09083. 10.1038/nature09083 PubMed 20520716