AAV-FLIM-AKAR
(Plasmid #63058)

• Purpose: Expresses the Fluorescence Lifetime Imaging Microscopy (FLIM)-compatible PKA activity sensor FLIM-AKAR in an AAV backbone
• Depositing Lab: Bernardo Sabatini
• Publication: Chen et al Front Pharmacol. 2014 Apr 2;5:56. doi: 10.3389/fphar.2014.00056. eCollection 2014.

Backbone

• Vector backbone: AAV-ChR2-mCherry
• Backbone manufacturer: Arpiar Saunders and Bernardo Sabatini
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 7300
• Modifications to backbone: N/A
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli (e.g. Invitrogen's Stbl3)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FLIM-AKAR
• Species: Synthetic
• Insert Size (bp): 1900
• Promoter: EF-1α

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTCTTCCATTTCAGGTGTCG
• 3′ sequencing primer: GAGGTTGATTATCGATAAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: FLIM-AKAR was modified from AKAR3 from Jin Zhang's laboratory at Johns Hopkins University.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry