CD63-pEGFP C2
(Plasmid #62964)

• Purpose: full length human CD63 cloned into pEGFP C2
• Depositing Lab: Paul Luzio
• Publication: Luzio lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP C2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD63 molecule
• Species: H. sapiens (human)
• Insert Size (bp): 749
• Mutation: CD63 has 1 silent mutation compared to the coding sequence of NM_001267698.1 N129 AAT instead of AAC
• GenBank ID: NM_001267698.1
• Entrez Gene: CD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5’ CCGACAACCACTACCTGAGC 3’
• 3′ sequencing primer: 5’ ACAAACCACAACTAGAATGCAG 3’

Resource Information

• Articles Citing this Plasmid:
  • 48 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Examples of use:

Blagoveshchenskaya AD, Hannah MJ, Allen S, Cutler DF. (2002) Selective and signal-dependent recruitment of membrane proteins to secretory granules formed by heterologously expressed von Willebrand factor. Mol Biol Cell 13:1582-1593.

Bampton ET, Goemans CG, Niranjan D, Mizushima N, Tolkovsky AM. (2005) The dynamics of autophagy visualized in live cells: from autophagosome formation to fusion with endo/lysosomes.
Autophagy 1: 23-36.

Harrison-Lavoie KJ, Michaux G, Hewlett L, Kaur J, Hannah MJ, Lui-Roberts WW, Norman KE, Cutler DF. (2006) P-selectin and CD63 use different mechanisms for delivery to Weibel-Palade bodies.
Traffic 7: 647-662.

Babich V, Meli A, Knipe L, Dempster JE, Skehel P, Hannah MJ, Carter T. (2008) Selective release of molecules from Weibel-Palade bodies during a lingering kiss. Blood 111: 5282-5290.

Babich V, Knipe L, Hewlett L, Meli A, Dempster J, Hannah MJ, Carter T. (2009) Differential effect of extracellular acidosis on the release and dispersal of soluble and membrane proteins secreted from the Weibel-Palade body.