lgp120+linker-pEGFP N1
(Plasmid #62963)

• Purpose: rat lgp120 + 10 amino acid linker cloned into pEGFP N1. The linker separates the targetting motif in lgp120 from EGFP.
• Depositing Lab: Paul Luzio
• Publication: Luzio lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: lgp120
• Species: R. norvegicus (rat)
• Insert Size (bp): 1281
• Mutation: has 2 amino acid mutations compared to the coding sequence of NM_012857.2 D50E N371Y
• GenBank ID: NM_012857.2
• Entrez Gene: Lamp1 (a.k.a. LGP120)
• Promoter: CMV
• Tags / Fusion Proteins:
  • linker (C terminal on insert)
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5’ CCAAAATCAACGGGACTTTCC 3’
• 3′ sequencing primer: 5’ CAGCTTGCCGTAGGTGGC 3’

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 10 amino acid linker was designed using the sequence as described below but with different cloning sites (EcoRI and BamHI):
Patterson GH and Lippincott-Schwartz J. (2002) A Photoactivatable GFP for Selective Photolabeling of Proteins and Cells. Science 297, 1873-1877.

Examples of use:

Jahreiss L, Menzies FM, Rubinsztein DC. (2008) The itinerary of autophagosomes: from peripheral formation to kiss-and-run fusion with lysosomes. Traffic 9: 574-587.

Renna M, Schaffner C, Winslow AR, Menzies FM, Peden AA, Floto RA, Rubinsztein DC. (2011) Autophagic substrate clearance requires activity of the syntaxin-5 SNARE complex. J Cell Sci 124:469-482.

Ogunbayo OA, Zhu Y, Shen B, Agban E, Li J, Ma J, Zhu MX, Evans AM. (2015) Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family. J. Biol. Chem. 290: 1086-1095.