Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Endolyn-delta pMEP4
(Plasmid #62962)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62962 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    delta pMEP4
  • Backbone manufacturer
    Girotti and Banting, PMID 9013339
  • Modifications to backbone
    pMEP4 (Invitrogen), lacking a non-essential 4.5 kb region (nucleotides 5,570-10,114)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Endolyn
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    626
  • GenBank ID
    AJ238574.1
  • Entrez Gene
    Cd164 (a.k.a. MGC-24v)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhei (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer 5’ AACCCGCGTGCAACCTGT 3’
  • 3′ sequencing primer 5’ CTTGTTTATTGCAGCTTATAATGG 3’
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Endolyn-delta pMEP4 was a gift from Paul Luzio (Addgene plasmid # 62962 ; http://n2t.net/addgene:62962 ; RRID:Addgene_62962)
  • For your References section:

    Endolyn is a mucin-like type I membrane protein targeted to lysosomes by its cytoplasmic tail. Ihrke G, Gray SR, Luzio JP. Biochem J. 2000 Jan 15;345 Pt 2:287-96. PubMed 10620506