Skip to main content
Addgene

Mucolipin1 D471-472K-pHcRed C1
(Plasmid #62961)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62961 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHcRed1 C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mucolipin-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1761
  • Mutation
    D471/472K (and two silent mutations T77 ACA instead of ACG N328 AAT instead of AAC)
  • GenBank ID
    NM_020533.2 Q9GZU1
  • Entrez Gene
    MCOLN1 (a.k.a. LECD, MG-2, ML1, ML4, MLIV, MST080, MSTP080, TRP-ML1, TRPM-L1, TRPML1)
  • Promoter CMV
  • Tag / Fusion Protein
    • HcRed (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer 5’ CACCGACATCCGGCTCCAGATG 3’
  • 3′ sequencing primer 5’ GGACAAACCACAACTAGAATGCAGTG 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Mucolipin1 D471-472K-pHcRed C1 was a gift from Paul Luzio (Addgene plasmid # 62961 ; http://n2t.net/addgene:62961 ; RRID:Addgene_62961)
  • For your References section:

    Mucolipin-1 is a lysosomal membrane protein required for intracellular lactosylceramide traffic. Pryor PR, Reimann F, Gribble FM, Luzio JP. Traffic. 2006 Oct;7(10):1388-98. 10.1111/j.1600-0854.2006.00475.x PubMed 16978393