Mucolipin1-pHcRed C1
(Plasmid #62959)

• Purpose: full length human Mucolipin-1 cloned into pHcRed1 C1
• Depositing Lab: Paul Luzio
• Publication: Pryor et al Traffic. 2006 Oct;7(10):1388-98.

Backbone

• Vector backbone: pHcRed1 C1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mucolipin-1
• Species: H. sapiens (human)
• Insert Size (bp): 1830
• Mutation: Mucolipin-1 has 1 silent mutation compared to the coding sequence of NM_020533.2 N328 AAT instead of AAC
• GenBank ID: NM_020533.2 Q9GZU1
• Entrez Gene: MCOLN1 (a.k.a. LECD, MG-2, ML1, ML4, MLIV, MST080, MSTP080, TRP-ML1, TRPM-L1, TRPML1)
• Promoter: CMV
• Tag / Fusion Protein:
  • HcRed1 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: 5’ CACCGACATCCGGCTCCAGATG 3’
• 3′ sequencing primer: 5’ GGACAAACCACAACTAGAATGCAGTG 3’

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry