Skip to main content
Addgene

VAMP7 HA-delta pMEP4
(Plasmid #62958)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62958 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    delta pMEP4
  • Backbone manufacturer
    Girotti and Banting, PMID 9013339
  • Modifications to backbone
    pMEP4 (Invitrogen), lacking a non-essential 4.5 kb region (nucleotides 5,570-10,114)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VAMP7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    708
  • GenBank ID
    NM_005638.5
  • Entrez Gene
    VAMP7 (a.k.a. SYBL1, TI-VAMP, TIVAMP, VAMP-7)
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5’ AACCCGCGTGCAACCTGT 3’
  • 3′ sequencing primer 5’ CTTGTTTATTGCAGCTTATAATGG 3’
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VAMP7 HA-delta pMEP4 was a gift from Paul Luzio (Addgene plasmid # 62958 ; http://n2t.net/addgene:62958 ; RRID:Addgene_62958)

  • For your References section:

    Molecular basis for the sorting of the SNARE VAMP7 into endocytic clathrin-coated vesicles by the ArfGAP Hrb. Pryor PR, Jackson L, Gray SR, Edeling MA, Thompson A, Sanderson CM, Evans PR, Owen DJ, Luzio JP. Cell. 2008 Sep 5;134(5):817-27. doi: 10.1016/j.cell.2008.07.023. 10.1016/j.cell.2008.07.023 PubMed 18775314
Related items:
Commonly requested with: