pJEP212-Lenti-1.3CaMKII-P-Intron-MCS-WPRE-pA
(Plasmid
#62931)
-
Purpose(Empty Backbone) pLenti vector backbone containing a 1.3CaMKII promoter followed by an intron followed by multiple cloning site(MCS) (reverse orientation).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62931 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti7.3DEST
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 8153
-
Modifications to backboneModified the backbone by removing the emGFP expression cassette and adding a multiple cloning site (MCS)
-
Vector typeLentiviral
- Promoter 1.3αCaMKII
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer aaaggtacctcgtaacattatggccttaggtcacttcatctccatggggttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP212-Lenti-1.3CaMKII-P-Intron-MCS-WPRE-pA was a gift from Jonathan Ploski (Addgene plasmid # 62931 ; http://n2t.net/addgene:62931 ; RRID:Addgene_62931) -
For your References section:
The production of viral vectors designed to express large and difficult to express transgenes within neurons. Holehonnur R, Lella SK, Ho A, Luong JA, Ploski JE. Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7. 10.1186/s13041-015-0100-7 PubMed 25887710