PX856
(Plasmid #62888)

• Purpose: C-term SpCas9 piece of inducible transcriptional activator (dCas9(C)-FKBP-2xNLS-VP64)
• Depositing Lab: Feng Zhang
• Publication: Zetsche et al Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149.

Backbone

• Vector backbone: PX330
• Backbone manufacturer: Zhang lab
• Backbone size w/o insert (bp): 4222
• Total vector size (bp): 7351
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SpCas9 (aa536-1368)
• Insert Size (bp): 3129
• Mutation: Asparagine 863 to Alanine (N863A)
• Promoter: CBh
• Tags / Fusion Proteins:
  • NLS SV40 (N terminal on insert)
  • FKBP12 (N terminal on insert)
  • NLS (C terminal on insert)
  • VP64 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age1 (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: ctggagcacctgcctgaaatcact
• 3′ sequencing primer: GGCTGATCAGCGAGCTCTAG

Resource Information

• Supplemental Documents:
  • PX856 annotated sequence
• A portion of this plasmid was derived from a plasmid made by: SpCas9 piece was PCR amplified of PX429
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry